maxinealvarez275 maxinealvarez275

03-01-2022
Mathematics

contestada

A physician orders a dosage of 85mg. The drug on hand is labeled “0.1g in 1.5mL”. How many ML should the pharmacy technician give the patient?

Respuesta :

Аноним Аноним

03-01-2022

Answer:

Step-by-step explanation:

0.1 g = 100 mg

85 mg / 100 mg = x mL / 1.5 mL

x = 1.275 mL

Answer Link

Otras preguntas

The perimeter of an equilaterak triangle is 858 millimeters. find the length of each side

Social ___ is a large category of people who share many similar levels of wealth , power, and prestige

The hydrosphere includes _____ 2.20 unit assessment: fundamentals of ecology, part 1

When did christianity become the official religion of the roman empire?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

6. Which of the following is a consequence of chronic alcohol use? A. gastritis B. stomach ulcers C. heartburn D. All of the above

Jay belsky believes that a major source of family stress is that society does not

What transportation technology made getting around in cities easier in the mid to late 1800s? A. Automobiles B. Cable cars C. Gondolas D. Horses

How does the receptor make the organism successful in reacting to their environment?

what's the ph of citric acid