gonzalezisaiah24687 gonzalezisaiah24687
  • 04-03-2020
  • History
contestada

What two other government officials were chosen for assassination when Lincoln was killed?

Respuesta :

degyt
degyt degyt
  • 04-03-2020

Answer:

William Seward and Andrew Johnson

Explanation:

Answer Link

Otras preguntas

Farmer brown built a rectangular pen for his chickens using 12 meters of fence. • he used part of one side of his barn as one length of the rectangular pen. • h
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
why did the church oppose the heliocentric theory
Less developed countries (LDCs) have a/an____ population growth. A.average B. negative C. positive D. unchanged
Solving this question
When a red blood cell is placed in hypertonic (very concentrated) solutions of nacl?
At the height of the vietnam war, the united states stationed approximately how many troops in vietnam?
what value or values for x make the following inequality true? |x-3|=13 a)11 b)-10 c)-15 d)15
A guaranteed protection against vague laws is known as which of the following?
Your religious identity is only important for you within your family and does not matter in the public sphere.