whoiszelly whoiszelly

02-08-2020
Mathematics

contestada

Find the unknown angle measure. A -50° b - 180° c - 220° d - 40°

Find the unknown angle measure A 50 b 180 c 220 d 40 class=

Respuesta :

Аноним Аноним

02-08-2020

Answer:

40 degrees

Step-by-step explanation:

90 degrees + 50 degrees = 140 degrees

there are 3 angles that total at 180 degrees in every triangle

180 degrees - 140 degrees = 40 degrees

Answer Link

Otras preguntas

What would be the △Y and the △X for the line that passes through the points (–5, 4) and (2, –2)

Which is a classification of emphysema? (select all that apply.) centriacinar parenchyma panacinar paraseptal bullae?

This rectangular prism is created with centimeter cubes. how many cubed centimeters make up this prism? rectangular prism composed of unit cubes. cm3

If a car's __________ is malfunctioning, people in the car will become ill when driving long distances, especially if the windows are closed. A. braking system

When you prepare to make a left turn from a one-way road into a two-way road, you must:?

A guaranteed protection against vague laws is known as which of the following?

What is the distance between 407 squared and negative 68 squared

Which biomolecule is primarily responsible for providing you with energy?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Brainliest, what is the total measure of angles 8 and 5 of angle 7 equals 61