josephalfaro josephalfaro
  • 02-10-2020
  • Mathematics
contestada

i need an answer asap

i need an answer asap class=

Respuesta :

Jayden1508
Jayden1508 Jayden1508
  • 02-10-2020
It’s not loading in the picture! Did u fr put a picture or is my phone glitching
Answer Link

Otras preguntas

-5(x+2)+6=3(x+4)please help​
List all of the prime numbers between 10-20.
Does an equalateral triangle have a hypotenuse?
Translate the sentence into an equation. Twice the difference of a number and 7 is equal to 2. Use the variable y for the unknown number.
A copper solution is light blue. The Cu(NH3)4 2+ ion is deep blue. What chemical is added to produce another color on the right
How does the passage develop the conflict? It introduces the narrator as a student who is laughed at by others because of her clothing and her father's employme
An embryo develops inside the ________.​
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
24+82 rounding or compatible numbers to estimate the sum
hello can someone help me plss. - choose any picture of air pollution. 1-describe the picture.2-name the problem. 3-talk about the dangers. 4-find the solutions