Seudónimo Seudónimo

02-12-2020
Chemistry

contestada

What is the amount of water vapor in the air called?

relative humidity

humidity

dew point

freezing point

Respuesta :

02-12-2020

Answer:

relative humidity

Explanation:

Answer Link

Otras preguntas

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.

Select the correct answer.What is the image of this figure after this sequence of dilations?1. dilation by a factor of -1 centered at the origin2. dilation by a

what is the effect on the graph of the equation y=-2x^2 when the equation is changed to y=2^2 ?

Lisa's rectangular living room is 20 feet wide. If the length is 5 feet less than twice the width, what is the area of her living room?

Hii I really need help right now I don’t understand.

Jose is riding his bicycle. He rides for 14.4 kilometers at a speed of 9 kilometers per hour. For how many hours does he ride?hours:

I need a little help understanding this

Question 8 of 10What should you multiply the first equation (top equation) by in order toeliminate the variable x when the two equations are added together?(3x-

Suppose that tan(x)csc(x)=1/f(x).Write f(x) in terms of sin(x) and cos(x).f(x)=

For questions 7-8: P is the center of a circle with diameter KR.7. If P(7,-5) and R(4,-2), find the coordinates of point K.8. What is the length of the radius t