cynthiGMarc8ieartyl cynthiGMarc8ieartyl
  • 03-12-2016
  • Mathematics
contestada

Select the prime number and multiply by 1000

Respuesta :

Аноним Аноним
  • 03-12-2016
I think I found one prime number that are not in decimal it's 2 and the answer is 500
Answer Link
treverfountain treverfountain
  • 03-12-2016
for example 13 is a prime number and multiply by it gives 13000

Answer Link

Otras preguntas

Is it ok to have a gun on campus if its a school's gun for shooting(marksmenship)?
Hal bought 5 pencils for $0.56 each.How much did he pay in total?
please help ill make you the brainlyest!!
The outside temperature was 2°F. How many degrees below the freezing point was the outside temperature?
Ai Mi went to the store to buy some chicken. The price per pound of the chicken is $3.50 per pound and she has a coupon for $2.50 off the final amount. With the
Whats 1234667x1888900988789 whats the square root of 2 and does anyone wanna talk?
A simile is an indirect comparison.Select one:TrueOr False and why​
Just need formulas not the whole explanation​
With which of these statements would Cleisthenes most likely agree? A Oligarchy, or government by a few people, is the best way to rule a city-state. В B. Democ
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU