donkee20001 donkee20001

01-02-2017
Biology

contestada

In a cladogram, when does a group of organisms branch off?

Respuesta :

sneakerplugaj sneakerplugaj

19-04-2019

Answer: When a new trait evolves (option A)

Answer Link

Otras preguntas

Frederick douglass' ability to read and write furthered the ______________ movement that ultimately put an end to ________________ in the u.s.

What is skeletal connective tissue? Give its function

What type of government did germany, italy, and japan have in the 1930s? (world war ii and postwar america unit, lesson 1)?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Occurs/Exists when the owner-manager makes all major decisions and monitors all activities while the staff serves as an extension of the managers supervisory a

The culture of children strongly approves of children tattling on one and other. a. True b. False

Questions 1–10: Identify each redundant expression. Some sentences contain no redundancies. 1. Weather conditions forced the regional managers to postpone thei

What’s the answer to #12? and why

(hc) "in the government of this commonwealth, the legislative department shall never exercise the executive and judicial powers, or either of them. the executiv

Jay belsky believes that a major source of family stress is that society does not