cenzzzzzzzzie cenzzzzzzzzie

02-08-2017
Biology

contestada

The breakdown of rocks due to wind is an example of

mechanical weathering
chemical weathering
erosion
molecular weathering

Respuesta :

02-08-2017

The answer is Erosion

Answer Link

percypercy168otvzio percypercy168otvzio

02-08-2017

Erosion since wind can make rocks loose or roll them over to break them down

Answer Link

Otras preguntas

What body systems are used to pick up a pencil and write down a few sentences in the space below? Fingers, Hand and arms is not what I’m looking for.

On The Magic School Bus, you find yourself traveling from Earth to the Moon. It is approximately 240 million miles. Once there, you realize you must turn 90 deg

Does the increase in blood glucose levels increase the viscosity of the blood

What is the requirement when ratifying a proposed amendment to the United States Constitution? A. approval of three quarters of states in a state convention B.

Which of the following was a territory the United States took from Spain after the Spanish–American War? A. Puerto Rico B. Hawaii C. Cuba D. A

Does the increase in blood glucose levels increase the viscosity of the blood

Why is it important for scientists to use blind tests?

Which tortoises, mainland or island, need to eat more food per gram of their body mass?

What is [tex] \frac{1}{x+2} +\frac{6}{x-5} [/tex] equal to?Please show most of your work!!!Thank you!!

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat