adilenelopez378 adilenelopez378

03-10-2017
English

contestada

What causes the narrator to stay for a few days at Henry's cottage?

Respuesta :

chris112211 chris112211

03-10-2017

Because the man said his beautiful wife was coming and the narrator wanted to meet her

Answer Link

Otras preguntas

plz help 10 pts A temporary magneta easily loses its magnetism.b has two north poles.c keeps its magnetism for a long time.d cannot be destroyed.

Which of the following was a territory the United States took from Spain after the Spanish–American War? A. Puerto Rico B. Hawaii C. Cuba D. A

SECTION 1 OF 1 1234567891011121314 Consider the following three statements: As children grow older, their weight increases. As children grow older, they expand

Percy Bysshe Shelley's poem "Ode to the West Wind" is significant because it A. explores the human need for love and companionship. B. uses satire to make fun

Which of the following was a territory the United States took from Spain after the Spanish–American War? A. Puerto Rico B. Hawaii C. Cuba D. A

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

To what does the poet compare the lass? A. nomads B. musicians C. birds D. sailors

Which of these describes an endothermic process? When lithium is placed in water, the temperature of the container increases. The combustion of kerosene re

Frederick douglass' ability to read and write furthered the ______________ movement that ultimately put an end to ________________ in the u.s.

1 pts. what is one difference between primary and secondary succession? a. primary succession is rapid and secondary succession is slow. b. secondary succession