savgallegos22 savgallegos22
  • 04-10-2017
  • Biology
contestada

What is the main purpose of controlled variables in an experiment?

Respuesta :

Аноним Аноним
  • 04-10-2017
They help ensure changes in the independent variable are affecting the dependent variable. 
Answer Link
Choc17 Choc17
  • 04-10-2017
The control variable strongly influences experimental results, and is held constant during the experiment order to test the relative relationship of the dependent and independent variable
Answer Link

Otras preguntas

A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
How well did feudalism establish order in the Middle ages?
Do all your pet's offspring look the same? If no, then explain why they look different.
Fossils are most commonly found in which type of rock?
Simplify. (-1/2)(4times)(-2)(7y)(-1) A. –28xy B. –28 C. 28xy D. 27