jadent10 jadent10
  • 01-11-2017
  • Mathematics
contestada

Y -2 > -11 what is the answer to this

Respuesta :

Designerlove Designerlove
  • 01-11-2017
-9 because you add positive 2 to counter act -2 which gives you -9
Answer Link
leannfuller13
leannfuller13 leannfuller13
  • 01-11-2017
14???????????????????????
Answer Link

Otras preguntas

simplify the expression (-5)2. A. -10. B. 10. C. -25. D. 25.
Nitrogen , Carbon, Hydrogen, Calcium , Oxygen and Iron are all examples of a(n)
A picture frame has a perimeter of 100 cm. It’s width is 4 cm less than twice its length. What is the width of the picture frame? 18 cm 32 cm 48 cm 50 cm
Are these sentences simple, compound, complex, or Compound Complex?After we get the supplies, we need to draw up plans, and then we will create the project.Lero
what would happen to the nucleus if the mitochondria wasn't there
The second statement is the ___ of the first X > y Y > x The > are arrows btw, help me!
can anyone help me with this PLEASE HELP!!
points because you might need them, please only answer if you truly need the points. What makes you try in life? Are you happy? What would make you happy?
Read the text about earthquakes and tsunamis. On what should we blame earthquakes? They are the fault of faults, of course! The cracks and gaps in the tectonic
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'