kevincotilla123 kevincotilla123

02-03-2018
Biology

contestada

which morph do you think would be easier to see on a dark tree trunk

Respuesta :

fuzzybear1026 fuzzybear1026

02-03-2018

I'm not 100% sure which biology class you are in are you doing the moth activity? If so then I would believe that the light moth would be easier to see on a dark tree trunk

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What transportation technology made getting around in cities easier in the mid to late 1800s? A. Automobiles B. Cable cars C. Gondolas D. Hor

what does the constitution state about the interaction of the judicial branch and new laws

Can things of aluminum have a greater mass than things made of iron?

why is derek miller's social media post different than most?

I just need help with the equation part since when I keep doing I get the wrong answer.

What is skeletal connective tissue? Give its function

What was a major effect of the agricultural revolution in the united states during the late 1800's?

What is the value of x?

A 5-card hand is dealt from a deck of 52 cards. what is the probability that 4 are hearts