jvalerio29
jvalerio29 jvalerio29
  • 04-04-2018
  • Biology
contestada

List three ways weather satellite info is useful to people

Respuesta :

margiehester03
margiehester03 margiehester03
  • 04-04-2018
1) It warns them of upcoming dangerous weather
2) They can get to safety quicker 
3) and another way is that they know what weather they are gonna be having for the week

Answer Link

Otras preguntas

CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
Please answer theses division problems!! 9 divided by 3/7
What was George Washington's nickname?
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
how many cups of water should be mixed with 1/4 cup of vinegar to make the cleaning solution?
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5